Below you can find some of the tools for DNA and phylogenetic studies used by the Mycology Team.

Programs for phylogenetic analyses

• Bioedit (free, only for Windows)
• Clustal (free, for Mac and Windows)
• MacClade (free, only for Mac)
• Mesquite (free, only for Windows)
• Nona (free, only for Windows)
• PAUP (commercial, for Mac and Windows)
• POY (free, for Mac and Windows)
• TNT (free, for Mac and Windows)
• WinClada (free, only for Windows)

Primers

Nuclear ITS and 5.8S rDNA primers

• BasidLSU3-3: CGACTGACTTCAATCGT – Millanes et al. (2011)
• ITS1F: CTT GGT CAT TTA GAG GAA GTA A – Gardes & Bruns (1993)
• ITS4: TCC TCC GCT TAT TGA TAT GC – White et al. (1990)
• ITS5: GGA AGT AAA AGT CGT AAC AAG G – White et al. (1990)
• ITS1-LM: GAA CCT GCG GAA GGA TCA TT – Myllys et al. (1999)
• ITS2-KL: ATG CTT AAG TTC AGC GGG TA – Lohtander et al. (1998)

Nucler small subunit rDNA primers

• NS1: GTAGTCATATGCTTGTCTC – White et al. (1990)
• NS19: CCGGAGAAGGAGCCTGAGAAAC – Gargas and Taylor (1992)
• nu-SSU-0021-5': CTG GTT GAT TCT GCC AGT – Gargas & DePriest (1996)
• nu-SSU-0072-5', NS17UCB: CAT GTC TAA GTT TAA GCA A – Gargas & DePriest (1996), Gargas & Taylor (1992)
• nu-SSU-0402-5', NS19UCB: CCG GAG AAG GAG CCT GAG AAA C – Gargas & DePriest (1996), Gargas & Taylor (1992)
• nu-SSU-0497-3', NS18UCB: CTC ATT CCA ATT ACA AGA CC – Gargas & DePriest (1996), Gargas & Taylor (1992)
• nu-SSU-0819-5', NS21UCB: GAA TAA TAG AAT AGG ACG – Gargas & DePriest (1996), Gargas & Taylor (1992)
• nu-SSU-0852-3', NS20UCB CGT CCC TAT TAA TCA TTA CG – Gargas & DePriest (1996), Gargas & Taylor (1992)
• nu-SSU-1203-5': NS23UCB: GAC TCA ACA CGG GGA AAC TC – Gargas & DePriest (1996), Gargas & Taylor (1992)
• nu-SSU-1293-3', NS22UCB: AAT TAA GCA GAC AAA TCA CT – Gargas & DePriest (1996), Gargas & Taylor (1992)
• nu-SSU-1750-3', NS24UCB: AAA CCT TGT TAC GAC TTT TA – Gargas & DePriest (1996), Gargas & Taylor (1992)
• nuSSU1088Rb: CGGCACCTTACGAGAAATCAAAGTC – Millanes et al. (2011)
• SR8R: GAA CCA GGA CTT TTA CCT T – Vilgalys website
• SR4: AAA CCA ACA AAA TAG AA – Vilgalys website
• TnuSSU2-3: TTTTGATCCCCTAACCTTCGTTCT – Millanes et al. (2011)
• TnuSSU1-3: CTTTCGGAATACCAAAAGGGYCAAG – Millanes et al. (2011)

Nuclear large subunit rDNA primers

• BasidLSU1-5: TAGCGAACAAGTACCGTGAGG – Millanes et al. (2011)
• BasidLSU3-5: ACGATTGAAGTCAGTCG – Millanes et al. (2011)
• LR0R: ACC CGC TGA ACT TAA GC – Vilgalys website
• LR3R: GTC TTG AAA CAC GGA CC – Rehner & Samuels (1995)
• LR3: CCG TGT TTC AAG ACG GG – Rehner & Samuels (1995)
• LR5: ATC CTG AGG GAA ACT TC – Vilgalys & Hester (1990)
• LR7: TAC TAC CAC CAA GAT CT – Vilgalys & Hester (1990)
• LR5R: GAA GTT TCC CTC AGG AT – Vilgalys website
• nu-LSU-362-5': GCG CAC AAG TAG AGT GAT C – Döring et al. (2000)
• nu-LSU-401-3': CCT TTC AAC AAT TTC ACG T – Döring et al. (2000)

Mitochondrial small subunit rDNA primers

• mrSSU1: AGCAGTGAGGAATATTGGTC – Zoller et al. (1999)
• mrSSU3R: ATGTGGCACGTCTATAGCCC – Zoller et al. (1999)
• mtSSU1-KL: AGT GGT GTA CAG GTG AGT A – Lohtander et al. (2002)
• mtSSU2-KL: ATG TGG CAC GTC TAT AGC CCA – Lohtander et al. (2002)

Betatubulin primers

• Bt3-LM: GAA CGT CTA CTT CAA CGA G – Myllys et al. (2001)
• Bt10-LM: TCG GAA GCA GCC ATC ATG TTC TT – Myllys et al. (2001)

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primers

• Gpd1-LM: ATT GGC CGC ATC GTC TTC CGC AA – Myllys et al. (2002)
• Gpd2-LM: CCC ACT CGT TGT CGT ACC A – Myllys et al. (2002)

RNA polymerase II largest subunit, RPB1 primers

• gRPB1-Af: GAK TGT CCK GGW CAT TTT GG – Stiller & Hall (1997)
• fRBP1-Cr: CNG CDA TNT CRT TRT CCA TRT A – Matheney et al. (2002)

RNA polymerase II 2nd largest subunit, RPB2 primers

• fRPB2-7c: FAT GGG YAA RCA AGC YAT GGG – Liu et al. (1999)
• fRPB2-11aR: GCR TGG ATC TTR TCR TCS ACC – Liu et al. (1999)
• RPB2-7F: ATG GGK AAG CAR GCW ATG GG – Liu et al. (1999)
• RPB2-3053R: TGR ATY TTR TCR TCS ACC ATR TG – Reeb et al. (2004)

MCM7 primers

• X_mcm7_F: CGTACACYTGTGATSGATGTG – Leavitt (2010)
• Mcm7_1348rev: GAYTTDGCDACDCCDGGRTCWCCCAT – Schmitt et al. (2009)

IGS primers

• IGSf: TAGTGGCCGWTRGCTATCATT – Wirtz et al. (2008)
• IGSr: TGCATGGCTTAATCTTTGAG – Wirtz et al. (2008)

TSR1 primers

• Tsr1-1453for: GARTTCCCHGAYGARATYGARCT – Schmitt et al. (2009)
• Tsr1-2308rev: CTTRAARTAXCCRTGXGTXCC – Schmitt et al. (2009)

References for primers:

Döring, H. & Clerc, P., Grube, M. & Wedin, M. 2000. Mycobiont-specific PCR primers for the amplification of nuclear ITS and LSU rDNA from lichenized ascomycetes. Lichenologist 32: 200–204.

Gardes, M. & Bruns, T. D. 1993. ITS primers with enhanced specificity for basidiomycetes - application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113–118.

Gargas, A. & DePriest, P. T. 1996. A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA. Mycologia 88: 745–748.

Gargas, A. & Taylor, J. W. 1992. Polymerase chain reaction (PCR) primers for amplifying and sequencing 18S rDNA from lichenized fungi. Mycologia 84: 589–592.

Leavitt, S. D. 2010. Assessing traditional morphology- and chemistry-based species circumscriptions in lichenized ascomycetes: Character evolution and species delimitation in common western North American lichens. Ph.D. dissertation, Brigham Young University, Provo, Utah, USA.

Liu Y. L., Whelen S. & Hall B. D. 1999. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Molecular Biology and Evolution 16: 1799–1808.

Lohtander, K., Myllys, L., Sundin, R., Källersjö, M., & Tehler, A. 1998. The species pair concept in the lichen Dendrographa leucophaea (Arthoniales): Analyses based on ITS sequences. Bryologist 101: 404–411.

Lohtander K, Oksanen I, Rikkinen J. 2002. A phylogenetic study of Nephroma (lichen-forming Ascomycota). Mycological Research 106: 777–787.

Matheny, P. B., Liu, Y. J., Ammirati, J. F. & Hall, B. D. 2002. Using RPB1 sequences to improve phylogenetic inference among mushrooms (Inocybe, Agaricales). American Journal of Botany 89: 688–698.

Millanes A. M., Diederich P., Ekman S., Wedin M. 2011. Phylogeny and character evolution in the jelly fungi (Tremellomycetes, Basidiomycota, Fungi). Molecular Phylogenetics and Evolution 61: 12–28.

Myllys, L., Lohtander, K., Källersjö, M. & Tehler A. 1999. Sequence insertions and ITS data provide congruent information on Roccella canariensis and R. tuberculata (Arthoniales, Euascomycetes) Phylogeny. Molecular Phylogenetics and Evolution 12: 295–309.

Myllys, L., Lohtander, K. & Tehler, A. 2001. β-tubulin, ITS and group I intron challenge the species pair concept in Physcia aipolia and P. caesia. Mycologia 93: 335–343.

Myllys, L., Stenroos, S. & Thell, A. 2002. New genes for phylogenetic studies of lichenized fungi: glyceraldehyde-3-phosphate dehydrogenase and beta-tubulin genes. Lichenologist 34: 237–246.

Reeb V., Lutzoni F. & Roux C. 2004. Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Molecular Phylogenetics and Evolution 32: 1036–1060.

Rehner, S. A. & Samuels, G. J. 1995. Molecular systematics of the Hypocreales: a teleomorph gene phylogeny and the status of their anamorphs. Canadian Journal of Botany 73: 816–823.

Schmitt, I., Crespo, A., Divakar, P. K., Fankhauser, J. D., Herman-Sackett, E., Kalb, K., Nelsen, M. P., Nelson, N. A., Rivas-Plata, E., Shimp, A. D., Widhelm, T. & Lumbsch, H. T. 2009. New primers for promising single-copy genes in fungal phylogenetics and systematics. Persoonia 23: 35–40.

Stiller, J. W. & Hall, B. D. 1997. The origin of red algae: implications for plastid evolution. Proceedings of the National Academy of Sciences USA 94: 4520–4525.

Vilgalys, R. Conserved primer sequences for PCR amplification and sequencing from nuclear ribosomal RNA. Duke University, USA. Internet address http://www.biology.duke.edu/fungi/mycolab/primers.htm

Vilgalys, R. & Hester, M. 1990. Rapid genetic identifcation and mapping of enzymatically amplifed ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246.

White, T. J., Bruns, T., Lee, S. B. & Taylor, J. W. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M. A., Gelfand, D. H., Sninsky, J. J. & White T. J. (eds), PCR Protocols: a Guide to Methods and Application. Academic Press, San Diego, pp. 315–322.

Wirtz, N., Printzen, C. & Lumbsch, T. 2008. The delimitation of Antarctic and bipolar species of neuropogonoid Usnea (Ascomycota, Lecanorales): a cohesion approach of species recognition for the Usnea perpusilla complex. Mycological Research 112(4): 472–484.

Zoller, S., Scheidegger, C. & Sperisen, C. 1999. PCR primers for the amplification of mitochondrial small subunit ribosomal DNA of lichen-forming. Lichenologist 31: 511–516.